Biologie

E-learning jako vzdělávací nástroj školy 3. tisíciletí

  • Full Screen
  • Wide Screen
  • Narrow Screen
  • Increase font size
  • Default font size
  • Decrease font size

Transkripce

Email Tisk PDF

Transkripce je prvním krokem ve velmi složitém komplexu biochemických reakcí na buněčné úrovni zvaném proteosyntéza. Protosyntéza ve svém důsledku vede ke vzniku bílkovin – základních stavebních látek každého organismu.

Charakteristika transkripce

Je zdrojem veškeré RNA, kterou v buňce můžeme najít. Transkripce je jednoduše řečeno přepis genetické informace z DNA do RNA za pomoci enzymů RNA-polymeráz. U živočichů probíhá transkripce ve dvou kompartmentech – v jádře a v mitochondriích. U rostlin pak ještě v chloroplastech.

Jak už víme z předešlých kapitol, DNA je v jádře uložena jako lineární sled nukleotidů, který má ve fenotypu konkrétní projev na úrovni buňky i celého organismu. Tento projev je realizován bílkovinami, ale také některými RNA (rRNA, tRNA, microRNA). Proteiny však z DNA vznikají nepřímo přes RNA.

realizace_genet_informace

Obrázek č. 1 Realizace genetické informace (Ústřední dogma molekulární biologie).

Realizace genetické informace však nefunguje tak, že z jednoho genu vznikne jedna mRNA. Při takové situaci by nasyntetizování potřebného množství proteinů trvalo příliš dlouho. Podle jednoho genu tak může vznikat více kopií mRNA (tento proces se nazývá amplifikace).

transkripce_amplifikace

Obrázek č. 2 Možná amplifikace při transkripci.

Při transkripci je důležité vzít na vědomí ještě jednu skutečnost. DNA, jakožto molekula složená ze dvou polynukleotidových řetězců, má jeden kódující a jeden nekódující řetězec. Pokud je složení řetězců například takové:

1. řetězec DNA:     AAGCGTTTGGAACGATATGTACG

2. řetězec DNA:    TTCGCAAACCTTGCTATACATGC

řetězec mRNA:     AAGCGUUUGGAACGAUAUGUACG

Pak je řetězec mRNA sice kódován podle 2. řetězce DNA, avšak syntéza probíhá podle komplementarity bází. Pokud však porovnáme 1. řetězec DNA s mRNA, zjistíme, že jsou naprosto stejné (kromě výměny Thyminu za Uracil). Proto je vždy vzdálenější (v našem případě první) řetězec DNA považován za kódující řetězec a bližší (v našem případě druhý) řetězec DNA za nekódující řetězec.

 

Transkripce eukaryot

Transkripce je ve svých základních rysech stejná pro všechny organismy, avšak u eukaryot najdeme některé specifika a rozdíly oproti transkripci u prokaryot. Probíhá v jádře a vyžaduje transkripčně aktivní chromatin (u prokaryot probíhá volně v cytoplazmě na jednovláknové cyklické molekule DNA), její průběh katalyzují tři různě RNA-polymerázy (u prokaryot pouze jedna RNA-polymeráza) a primární transkripty (produkty transkripce) podléhají posttranskripčním úpravám (u prokaryot primární transkripty nepodléhají žádným posttranskripčním úpravám).

 

RNA polymerázy

Tři RNA polymerázy katalyzující transkripci u eukaryot mají také své specifické působení. RNA polymeráza I katalyzuje transkripci genů pro tvorbu rRNA, RNA polymeráza II geny pro tvorbu mRNA a RNA polymeráza III geny pro tvorbu tRNA. Kromě těchto polymeráz jsou zde ještě obecné transkripční faktory, které aktivují tyto RNA polymerázy a vyhledávají na řetězci všechny místa, kde mají tyto polymerázy účinkovat (tzv. promotory)

Pro představu složitosti těchto molekul, zde je molekula RNA-polymerázy II:

rna_polymerazaII

Obrázek č. 3 Molekula RNA-polymerázy II; červeně je znázorněn hořečnatý iont Mg2+, modře pak ionty zinečnaté Zn2+.


Průběh transkripce

Celá transkripce začíná tvorbou tzv. iniciačního transkripčního komplexu. Jedná se vlastně o seskupení enzymů a všech dalších faktorů, které podmiňují začátek transkripce na konkrétním úseku DNA, od kterého započne syntéza řetězce mRNA. Tento jev se nazývá iniciace.

transkripce_iniciace

Obrázek č. 4 Začátek transkripce; Pro představu vidíme celý iniciační transkripční komplex složený z hlavních transkripčních faktorů, RNA polymeráz, různých mediátorů, komplexu pro remodelaci chromatinu a dalších enzymů navázaný na konkrétním úseku DNA (označnovaném TATA box), od kterého poté začne probíhat transkripce a syntéza řetězce mRNA.

Celý transkripční komplex se poté pohybuje po řetězci DNA a syntetizuje nový řetězec mRNA. Tento proces se nazývá elongace prodlužování. Jakmile komplex narazí na specifickou sekvenci nukleotidů na DNA (tzv. terminační oblast), dojde k rozpadnutí celého transkripčního komplexu, RNA polymerázy ukončí svou funkci a transkripce je ukončena. Proces ukončení transkripce se nazývá terminace.

Jak bylo řečeno výše, produkty transkripce u eukaryot podléhají posttranskripčním úpravám. Ty jsou nutné, neboť transkripcí v eukaryotických buňkách vznikají pouze prekurzory jednotlivých RNA. Nejdůležitějším produktem transkripce je tzv. hnRNA – heterogenní jaderná RNA (z angl. heterogeneous nuclear RNA), která je prekurzorem pro mRNA. mRNA je velmi důležitá, neboť právě tento typ RNA přenese genetickou informaci z jádra do cytoplazmy na ribozomy, kde probíhá další část proteosyntézy – translace (vznik proteinů).

(Pozn. autora: Dalšími primárními transkripty transkripce jsou pre rRNA (prekurzory pro rRNA, kterou můžeme najít v malé a velké ribozomální podjednotce), prekursorová tRNA (pre tRNA) a dále několik malých RNA – konkrétně jsou to snRNA (small nuclear RNA – malá jaderná RNA, podílí se na vystřihávání intronů z pre mRNA – jev zvaný splicing - viz. níže), snoRNA (small nucleolar RNA – malá jadérková RNA – podílí se na posttranskripčních úpravách hnRNA), scRNA (small cytoplasmic RNA – malá cytoplazmatická RNA) a miRNA (microRNA).)

VIDEO průběh transkripce: http://www.youtube.com/watch?v=WsofH466lqk;

Posttranskripční úpravy hnRNA – vznik mRNA

Ke vzniku mRNA z hnRNA vedou tři základní posttranskripční úpravy. První je navázání sloučeniny 7-metylguanosin na 5´ konci řetězce. Tato sloučenina je důležitá pro iniciaci translace. Druhou je polyadenylace 3´ konce, což má význam při transportu mRNA do cytoplazmy a také pro regulaci stability budoucí molekuly mRNA. Třetí úpravou je tzv. splicing (čti „splajsing“, česky sestřih). Jedná se o vystřižení nekódujících sekvencí řetězce - intronů a ponechání kódujících sekvencí – exonů. Jako všude i zde existují určité výjimky. Některé exony mohou být i přesto, že jsou kódující, z řetězce vystřiženy. Takovým exonům se říká potencionální exony. Naproti tomu exony, které nemohou být odstraněny nikdy, se nazývají konstruktivní exony. Tomuto jevu odstraňování potencionálních exonů se říká alternativní sestřih. Pokud jsou některé/všechny potencionální exony vystřiženy, dochází v důsledku ke vzniku několika různých mRNA, a také několika různých bílkovin pouze z jednoho genu. Až po proběhnutí těchto 3 úprav vzniká mRNA, která je dále transportována do cytoplazmy k ribozomům.

 

posttranskripcni_upravy

Obrázek č. 5 Posttranskripční úpravy - vznik mRNA z hnRNA.

Opakovací otázky:

  1. Vysvětli pojem proteosyntéza, proč je tento proces pro organismy tak důležitý?
  2. Odkud kam probíhá přepis genetické informace při transkripci:
  3. Popiš iniciaci transkripce
  4. Co je splicing?
  5. K čemu slouží posttranskripční úpravy?
  6. Kolik RNA polymeráz katalyzuje transkripci u eukaryot?

Autor: Tomáš Durčák